Beyond Your Direct Suppliers: Finding Risks Before They Disrupt Your Supply Chain
click here to discover importer exporter profiles & logistic partners
Shipments
Trading Partners
Markets
Products/HS Code
Exports Data of
gene tools llc
summerton way, united states
gene tools llc is based out of united states with 5 export shipments recorded in global import export data.
Trade Trends of gene tools llc
from Jan 2022 to Dec 2025Shipments Imported: 0
As Buyer Trade Value (USD): $0
Shipments Exported: 5
As Supplier Trade Value (USD): $7.47 K
Import and Export shipments of "gene tools llc"
As Supplier
| Consignee Name | Shipper Name | HS Code | Shipment Weight (kg) | Product Keywords | Shipment Date |
|---|---|---|---|---|---|
| 382219 | 0.075 | F-VIVO-MORPHOLINO 400 nmol synthetic non-toxic reagent for scientific research oligonucleotides) F-VIVOEX10PMO2IL1RL2RN10A 46-23NOV25BV-K-5F AAGATCTTCAACACCACTGTGTCCA antisense oligonucleotides with a fluorescent label to block the expression of target genes. Used exclusively in scientific research. Principle of action: they specifically bind to mRNA and block translation. FORM: lyophilized bath | Dec 29, 2025 | ||
non commercial jsc | gene tools llc | 382219 | 0.075 | F-VIVO-MORPHOLINO 400 nmol synthetic non-toxic reagent for scientific research oligonucleotides) F-VIVOEX10PMO2IL1RL2RN10A 46-23NOV25BV-K-5F AAGATCTTCAACACCACTGTGTCCA antisense oligonucleotides with a fluorescent label to block the expression of target genes. Used exclusively in scientific research. Principle of action: they specifically bind to mRNA and block translation. FORM: lyophilized bath | Dec 29, 2025 |
non commercial jsc | gene tools llc | 382219 | 0.075 | F-VIVO-MORPHOLINO 400 nmol synthetic non-toxic reagent for scientific research oligonucleotides) F-VIVOEX10PMO2IL1RL2RN10A 46-23NOV25BV-K-5F AAGATCTTCAACACCACTGTGTCCA antisense oligonucleotides with a fluorescent label to block the expression of target genes. Used exclusively in scientific research. Principle of action: they specifically bind to mRNA and block translation. FORM: lyophilized bath | Dec 29, 2025 |
non commercial jsc | gene tools llc | 382219 | 0.075 | F-VIVO-MORPHOLINO 400 nmol synthetic non-toxic reagent for scientific research oligonucleotides) F-VIVOEX10PMO2IL1RL2RN10A 46-23NOV25BV-K-5F AAGATCTTCAACACCACTGTGTCCA antisense oligonucleotides with a fluorescent label to block the expression of target genes. Used exclusively in scientific research. Principle of action: they specifically bind to mRNA and block translation. FORM: lyophilized bath | Dec 29, 2025 |
non commercial jsc | gene tools llc | 382219 | 0.075 | F-VIVO-MORPHOLINO 400 nmol synthetic non-toxic reagent for scientific research oligonucleotides) F-VIVOEX10PMO2IL1RL2RN10A 46-23NOV25BV-K-5F AAGATCTTCAACACCACTGTGTCCA antisense oligonucleotides with a fluorescent label to block the expression of target genes. Used exclusively in scientific research. Principle of action: they specifically bind to mRNA and block translation. FORM: lyophilized bath | Dec 29, 2025 |
Trademo turns 3B+ shipment records and 15M+ company profiles into actionable data for trade prospecting. Subscribe to Trademo Intel to grow the pipeline.
Solutions Built for Every Stage of Global Trade
Global Trade Management
Discover end-to-end compliance automation across classification, screening, and duties.
Know more
Intel
Discover high-potential prospects, qualify opportunities, and grow your pipeline.
Know more
SourceAtlas
Discover suppliers, compare sourcing markets, and make smarter sourcing decisions.
Know more
Trading Partners of gene tools llc
Top Companies "gene tools llc" is exporting to (by Value USD)
| Buyer | 2025 | 2022 |
|---|---|---|
non commercial jsc | 6.77 K | - |
university of the philippines | - | 700 |
Markets in which gene tools llc trades
Top Countries "gene tools llc" is exporting to (by Value USD)
| Importing Country | 2025 | 2022 |
|---|---|---|
 kazakhstan | 6.77 K | - |
 philippines | - | 700 |
Products/HS Codes traded by gene tools llc
Top HS Codes Exported by "gene tools llc"
USD 6.77 K | 60.00%
Miscellaneous chemical products Diagnostic or laboratory reagents on a backing, prepared diagnostic or laboratory reagents whether or not on a backing, whether or not put up in the form of kits, other than those of heading 30.06; certified reference materials. -- Other
Miscellaneous chemical products Diagnostic or laboratory reagents on a backing, prepared diagnostic or laboratory reagents whether or not on a backing, whether or not put up in the form of kits, other than those of heading 30.06; certified reference materials. -- Other
USD 700 | 40.00%
Organic chemicals Nucleic acids and their salts, whether or not chemically defined; other heterocyclic compounds. -- Other
Organic chemicals Nucleic acids and their salts, whether or not chemically defined; other heterocyclic compounds. -- Other
Intel
Identify in-market buyers, prioritize high-potential accounts, and accelerate pipeline growth.
Similar Companies to gene tools llc
Companies exporting similar HS Codes as of "gene tools llc" in united states
Other Buyers and Suppliers in united states who deal in similar products like gene tools llc
Explore Transformation Stories
How a US Freight Forwarder Generated
4x More Leads at $1 Cost Per Lead
Trademo’s global trade intelligence platform has allowed us to find leads easily, boosting the team’s productivity and making the process simpler.
Iliana Rodriguez
Operations Team Leader
Frequently Asked Questions
Who are the top buyers purchasing from Gene Tools Llc?
According to trade records, some of the top buyers of Gene Tools Llc include Non Commercial Jsc And University Of The Philippines.
Which countries does Gene Tools Llc trade with?
Customs data shows that Gene Tools Llc is most active in trade with countries such as Kazakhstan And Philippines.
How many shipments has Gene Tools Llc in last 12 months?
In last 12 months, Gene Tools Llc has been linked to 5 verified shipments tracked through international trade data.
What is the total export value of Gene Tools Llc in last 12 months?
The total recorded export value of Gene Tools Llc is estimated at $7.47 K till date, based on aggregated global shipment sources.
How can I analyze Gene Tools Llc global trade network?
With Trademo, you can explore Gene Tools Llc complete trade ecosystem including buyers, manufacturers, shipment volumes, and trade routes, helping you identify opportunities and risks.
APIs
Data License
Plans
Directories
Company
Location
United States
3000 El Camino Real, Building 4, Suite 200, Palo Alto, California 94306
India
2nd Floor, Plot No. 136, Sector 44, Gurugram, Haryana 122003
All rights reserved | Terms of use Copyright ©2025 Trademo Technologies Inc.